Sentence examples for purposes was generated from inspiring English sources

A heat map for visualization purposes was generated in the open source multiexperiment viewer software (http://www.tm4.org/mev), in which data were adjusted to a 0 1 scale for color expression coding.

Average waveforms for display purposes were generated by smoothing the data using 1 hr running averages.

Large numbers of SNPs amendable for high throughput genotyping purposes were generated for each genotype providing a very rich resource for fast development of markers in lily and tulip.

The flies required for this purpose were generated from backup vials that had excess (∼6 ml) food for larvae and yeast supplement for the adults, and were run in parallel with the experimental vials.

Antony Jenkins has won deserved plaudits by disbanding Barclays' structured capital markets business (SCM) and vowing that the bank will not engage in transactions where the primary purpose is generate a tax saving.

A second tree (for comparison purposes, not shown) was generated by applying a maximum parsimony method as implemented in the Mega software version 5.05 [ 81].

A second set of trees (for comparison purposes; not shown) was generated by applying a maximum parsimony method as implemented in the Mega software, version 5.05 [ 174].

For this purpose, a mesh was generated based on a CAD design of the real geometry, and several models were applied.

For this purpose a mask was generated using ImCalc implemented in SPM.

For control purposes, a scrambled sequence was generated and verified (scrRNA 5-3′CUCGACAUAACACUGGUGCUU).

For comparative purposes, an artificial dataset was generated to demonstrate the case in which technical noise was the primary cause of the observed data variation.