Sentence examples for publishing control from inspiring English sources

"For writers the important thing is having the publishing control and retaining your rights.

Miller has since retained publishing control over Lacan's texts, editing the Champ freudien book series in which official "established" versions of the annual seminars and other Lacanian writings appear.

This controller is evaluated and compared with other recently published control techniques.

Big booksellers, on the other hand, retort that it is publishers who hold the power, since they decide what to publish, control the copyrights to popular books and set cover prices.

The experimental results also show that, given the probe's constraints, the proposed controller provides more robust performance against large insertion perturbations than previously published control strategies developed for the probe.

To further evaluate the phylogenetic placement of the brown bear mtDNA generated in this study, we compiled a dataset of 225 published control region (CR) sequences for clades 3a, 3b, 3c and 4 (Supplementary Table 4).

India's National Disaster Management Authority has published control room phone numbers for flood-affected districts.

There were no differences between any of these controls and published control series, cementing the relevance of epsilon 4 for late-onset AD.

BMD measures were converted to age and gender normalized z scores based on our own previously published control series (n > 250).

Previously published control region sequences [ 15] were also included in the alignment (GenBank: U47061– U47061).

Morpholino sequences were: tnnt2 (ATG/start) blocking morpholino 5′CATGTTTGCTCTGACTTGACACGCA3′ as published, Control morpholino 5′CCTCTTACCTCAGTTACAATTTATA 3′ (Gene Tools stock control), and dll4 (ATG/start) blocking morpholino: 5′-GAGAAAGGTGAGCCAAGCTGCCATG-3′ as published.