Sentence examples for protection bases from inspiring English sources

"Why do we have protection bases being closed?" he asks.

The legendary protection system that Possuelo helped build is crumbling, as abandoned protection bases molder in the forest.

The following set of primers (with restriction enzyme cut site and protection bases in the 5′ end) was used: GGACTAGTGCTGCTGCTGTTGAGATA (forward primer) and CCCAAGCTTCAAGGGAACACTAAGATTAA (reverse primer).

To ensure that the protection bases its decision on an effective image of the circuit-breaker status, the position signal "OFF" was delayed with a configured timer while the circuit-breaker was actually opening.

Five internal XML (extensible markup language) databases [restriction enzymes, plasmids, universal buffers, PCR (polymerase chain reaction) protection bases, and an MCS (multiple cloning site) double digest interference database] were established to serve as the basic support for "CloneAssistant 1.0".

The AtPP2-A1 promoter was obtained by PCR using the genomic DNA from WT plant and the specific primers (5'- CC CandCTTGATAATTTTTCAAGACCC-3' and 5'- CGG GATCCAAACCAGTATGATGTATT-3'; underline indicates protection bases; italics indicate Hind III and BamH I restriction bases).

Models of protection based on the hypothesis that transcription protects CGIs must also consider the presence of stalled RNA polymerase at PRC-marked genes [ 173, 174].

In the first, we consider low protection, based on the percent of the biome's extension protected by the network, and high land use change.

The researchers chose three fabrics, not dyed, with different initial levels of UV protection based on the weave and other factors.

The court based its opinion on the Windsor decision, ruling that the Supreme Court had applied a new, heightened level of scrutiny for equal protection based on sexual orientation, even if it had not expressly articulated that new standard.

"What we're finding is that even though people are using antiperspirant, the products were not meeting the adequate level of protection based on their bodies' chemistry," Mr. Hochman said.