Sentence examples for promoter using from inspiring English sources

#BBCtrending meets the promoter using social media to fight for Bangalore's nightlife.

Transformation was also verified by PCR amplification of the ToxA promoter using genomic-DNA extracted from transformed mycelia as template (Figure 1d).

DLD1 cells were transfected with a SV40-RLuc carrying Renilla luciferase under the control of the SV-40 promoter, using two different techniques.

Values are expressed in comparison with those obtained from the reference promoter using the kanamycin resistance (aminoglycoside 3′-phosphotransferase) gene as a reporter.

Here, we studied the kinetic mechanism of basal transcription at the IL-2 promoter using a human in vitro RNA polymerase II transcription system.

The HCHL gene, encoding p-hydroxycinnamoyl-CoA hydratase/lyase, was introduced into B. vulgaris under the control of a CaMV 35S promoter, using Agrobacterium rhizogenes LBA 9402.

To enhance hemicellulase productivity in A. cellulolyticus, we transformed this fungus with the identified β-xylosidase gene driven by the cellobiohydrolase Ι (cbh1) promoter, using the protoplast-polyethyleneglycol (PEG) method, and obtained a transformant, YKX1.

The insert was then ligated into a pSM vector containing 1.8 kb of the unc-25 proximal promoter, using KpnI.

Each infectious clone was transcribed in vitro from the SP6 promoter using the mMESSAGE mMACHINE kit (Ambion) following manufacturer's instructions.

DMS-gal4 enhancer flies were produced by amplifying the putative DMS promoter using the following primers: GCGAGATCTCGGTGCTTCCACAAAGAAGT and GCGGAATTCCGCAAAGTGGCGAAAATAAT.

First, we tested whether TNF-α increases NF-κB complex binding to the PIK3CA promoter using the ChIP assay.