Sentence examples for promoter adapter from inspiring English sources
DIG-labelled RNA probes were made by amplifying target DNA from normal ovarian cDNA using the Expand High Fidelity PCR System (Roche, Mannheim, Germany) and the following primers: F3, CACAATAGACCATAACTCCT and R3, AAACGCCATTCAATTCTCTC. A T7 promoter adapter was ligated to the ends of both the sense and antisense PCR products (Lig'n Scribe, Ambion).
When targeted to the 5′ flanking region of a minimal promoter, this pso-TFO adapter increased the expression of a downstream reporter gene three- to four-fold.
EFG1 expression is probably regulated by additional proteins binding the EFG1 promoter directly or indirectly by adapter proteins including Efg1.
Genomic DNA was digested with either MspI or HpaII at 37°C overnight, purified and ligated to the first pre-annealed TruSeq-indexed Illumina adapters containing the T7 promoter sequence, as well as the EcoP15I recognition site (AE adapters [ 41]).
An anchored primer adapter was designed that contains a 5' T7 promoter and a 3' polyA (18 bps in length) stretch terminating in a single C, G, or T base.
These data indicate that LUH has repressor function and confirms the hypothesis that SLK1 and SLK2 function as adapter proteins to recruit LUH to the promoter to inhibit gene transcription.
We then expressed pro-Caspase-1 and adapter protein Asc in yeast under constitutive weak promoters, such that the amount of Asc produced was insufficient to activate pro-Caspase-1 in the absence of other cofactors.
First, we tried expressing the bridging adapter protein FADD at low levels using a constitutive but weak promoter such that the amount of FADD was inadequate to achieve pro-Caspase-8 activation in the absence of Fas.
For the first step, specific primers with appended adapters complementary to AttB1 and AttB2 sequences were used to generate 1000-bp pregions regiofs of tested genes (Tab. 2).
