Sentence examples for progressively employed from inspiring English sources

The rules for predicting ecological niche of a species are randomly developed and progressively employed on the training data set.

Illumina primers: pr1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT pr2: CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT Sequencing of the RESCAN libraries started with 25b reads on the original (2007) Genome Analyzer and progressively employed the improvements in chemistry and apparatus.

These biosynthesised nanoparticles are progressively been employed in wide range of applications in science, technology and medicine because of their distinctive optical and antimicrobial properties.

Fashion employed progressively younger models from the early 1960s, and by the late 80s 16-year-olds were commonplace: the sad contrast intensified between their reality and the affluent arrogance they were paid to project.

Morgan employed three progressively stronger defensive lines: a front line of skirmishers deployed behind trees, followed by Southern militia troops, and, finally, the regular Continental Army troops supported by Col. William Washington's cavalry reserve, positioned out of sight of Tarleton's forces.

To avoid unnecessary matching processes, a staged approach was employed which progressively linked the datasets two at a time.

The shift 30 years later may be due to owner of smaller herds being progressively only part time employed with the animal husbandry while the larger herds have become more aware of fertility management as an important economic factor.

Monday's parliamentary hearing, titled "On Problems in the Observation of Human Rights by the United States of America," was the first of its kind since the breakup of the Soviet Union, and comes as Russia's leaders employ progressively colder statements toward the United States.

And as the length of the workday becomes progressively longer, many of the employed are foregoing raises as well -- often for years.

As the applications for which lead acid batteries have been employed have become progressively more demanding in terms of energy stored, power to be supplied and service-life, a series of life-limiting functions have been encountered and then overcome.

Employing what we termed retrobiosynthetic analysis, we attempted to deconstruct the complex target compounds into progressively simpler molecules utilizing only the predicted constituent transforms employed by nature.