Your English writing platform
Discover LudwigExact(4)
Bivalve shellfish aquaculture is a recent practice relative to its history in other countries, beginning in the late 1800s along the U.S. West Coast where it is now well established with farm raised product utilizing land-based hatcheries and grow-out directly in numerous estuaries.
The high court will decide whether a federal court was correct in granting a permanent injunction against eBay for infringing a patent held by MercExchange a company, like NTP, that has no commercial product utilizing the patent in question.
We designed a forward primer (marked in yellow) in this region and were able to amplify a product utilizing a reverse primer in exon 25 (5′ CAGCGCATCGTCAAAGAGATG3′, spanning intron 24, 255 bp).
LDA relies solely on the frequency of reactions that fail to produce an amplification product, utilizing PCR to only determine whether a target molecule is present within an individual aliquot.
Similar(56)
The ElliQ product utilizes artificial intelligence to facilitate a more engaged lifestyle, by recommending activities and making it easy to connect with friends and family members.
The yarn the product utilizes up to 31 recycled plastic PET bottles making this brand a sustainable brand with the enviorment in mind.
Viral video aficionado Matthijs Vlot's "This Is My Product" utilizes a variety of clips to have characters from the AMC show spit rhymes that are straight up dope.
This product utilizes "vanishing optotypes" familiar in a toddler's life.
As was the case with vitamin E, the use of vitamin C in the current investigation, (30 [31.9%]) was similar to previously reported results, being the second most common product utilized by cardiovascular patients [ 21].
The company was founded in 1978 to develop positioning and navigation products utilizing LORAN (and subsequently GPS) technology.
Increased 5G connectivity would enable domestic companies to lead innovation in international markets for products utilizing millimeter wave spectrum.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com