Sentence examples for product to monitor from inspiring English sources
Instrument the product to monitor user flows and be able to test new ideas in how to iteratively improve your product.
Specifically, Conductor is announcing that there are 1,000 global brands (including Ticketmaster and Gilt Groupe) who use Conductor's Searchlight product to monitor and improve their ranking on Google, or whatever the dominant search engine is in a given country.
A first hybridization was performed using a 33P-labelled oligonucleotide (TAATACGACTCACTATAGGG) which is found at the extremity of each PCR product to monitor the amount of cDNA present in each spot.
A first hybridization was performed using a 33P-labelled oligonucleotide (TAATACGACTCACTATAGGG which is present at the extremity of each PCR product) to monitor the amount of cDNA in each spot.
A first hybridization was performed at 42°C for 48 h using a P-labelled oligonucleotide (TAATACGACTCACTATAGGG, sequence which is present at the extremity of each PCR product) to monitor the amount of cDNA in each spot.
A Vectorial Capacity Product to Monitor Changing Malaria Transmission Potential in Epidemic Regions of Africa.
A methodology is presented to optimize a sampling plan for retail products to monitor the prevalence of foodborne pathogens in relation to disease burden.
Nest users who depend on their connected products to monitor their homes experienced a hiccup in connectivity Saturday that left users scrambling to figure out what was happening.
The ability of these smart connected products to monitor, control, optimize and automate systems changes the way leaders should think about their industries, their competitive advantage and their value chain.
Over the past several years, the remote sensing research community has used these products to monitor tropical deforestation, forest C stocks and associated C emissions, largely in support of REDD+ initiatives in developing countries [5 12].
As Box senior vice president of global marketing at Box Whitney Bouck put it, many companies are using these products to monitor security across enterprise and they will now include support to monitor Box.
