Sentence examples for product spanning from inspiring English sources

The PCR product spanning the gap was corresponded to the intron and was as such extremely AT-rich.

Recombinant GFP-DOR vectors were generated by cloning a PCR product spanning the murine DOR-ORF in-frame into the EcoRI and SalI sites of the pEGFP-C2 vector (Clontech).

The amplification product spanning the respective HA-Vpr/Vpx encoding gene was inserted into the mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA, USA) using the restriction sites BamH I and Xho I.

Quantitative real time RT-PCR was conducted using Smart Cycler II (Cepheid) with SYBR green (Cepheid) to detect subgenomic cDNA with primers (7.5 pM) optimized to detect a product spanning the leader sequence to the 5' end of M gene or genomic cDNA with primers (7.5 pM).

Correct insertion of the Cre expression cassette within the MHV-68 BAC genome was confirmed by restriction digestion of BAC DNA (Figure 1B) followed by Southern analysis, as well as by direct DNA sequence analysis of a PCR product spanning the insertion site (data not shown).

The full length PCR product spanning exons 2 9 is expected to be 1017 bp in length.

The PCR product spans nucleotides 484610 to 485235 of Genbank accession number AE000155.

Quantitative real-time RT-PCR was conducted on a Bio-Rad CFX96 instrument using primers specific for Eutrema ACTIN1 (F - ACAGGGTGCTCTTCAGGAGCGAT; R - GCATGGTGTTGTGAGCAACTGGG), whose product spans an intron.

RT-PCR primers were designed such that the PCR product spanned an exon boundary, so that amplification from any contaminating genomic DNA could be eliminated.

The Mainframe Solutions segment offers products spanning various product areas, such as systems management, automation, application development, database management, and security.

Microsoft certainly has a lot of products spanning from the enterprise to the consumer where it can attach Skype: Windows Phone, Xbox, Exchange, SharePoint.