Sentence examples for product restriction from inspiring English sources

Suggestions(1)

Exact(6)

The local rectangular refinement (LRR) method maintains orthogonality at grid-line intersections but lifts the tensor product restriction common to traditional grids, producing unstructured grids.

We may lift the product restriction at any time to enable people to comment on any secret, after we all learn a little more about the platform".

The following primers introduced BglII and KpnI site, respectively, in the PCR product (restriction sequence underlined): 5'-AAAAGATCTATGGCCGTGCCTCCC-3'and 5'AAAGGTACCTGCTTGAAATTCCAGTCC 3' The gel purified PCR product was cloned in BglII-KpnI site of pEGFP-N3 (Clontech) vector, in frame with green fluorescent protein (GFP) and confirmed by sequencing.

If there were doubts concerning the identity of the amplified product, restriction endonuclease analysis was performed to confirm the specificity of the qRT2-PCR products.

The restriction enzyme HhaI recognized on the 820-bp UreC gene amplified PCR product restriction site 5'…GCG↓ C …3' giving 2 fragments varying in size from 100 bps to 550 bps and showing 4 band patterns while restriction enzyme Sau3A1 recognized site 5'…↓ GATC..3'giving 3 fragments ranging in size from 50 bps to 600 bps having 7 bands patterns, respectively.

Figure 2 shows that the PCR product restriction digests for the polymorphic P. falciparum merozoite protein 2 (Pfmsp2) (8) and the P. falciparum chloroquine resistance transporter (Pfcrt) (9) gene fragments were identical for patients 1 and 2. This identity was also confirmed by sequence analysis.

Similar(54)

[Page A1.] F.D.A. Warns Guidant of New Product Restrictions The Food and Drug Administration released a warning letter it sent to the Guidant Corporation, restricting the ability of the troubled heart device maker to win approval for some new products.

But several countries led by the UK and Croatia are opposing EU-wide mandatory pricing or product restrictions for plastic bags.

While measuring, organizations must consider whether security teams are hamstrung by infrastructure and product restrictions.

In a statement, it said there was no immediate impact on existing customers and access to funds would be made regardless of product restrictions.

"We worry that some of the product restrictions could make it harder for bankers to tailor products for their customers and communities and result in some creditworthy customers not being able to obtain a loan".

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: