Sentence examples for produced sequence from inspiring English sources

It also produced sequence changes at one or both of the 5′ and 3′ termini of half the sequences.

Through advancements in the fields of molecular biology and technical engineering, parallelization of the sequencing reaction has profoundly increased the total number of produced sequence reads per run.

The proposed scheme may have a negative impact on the randomness of the produced sequence since the FF code is highly structured.

Therefore, as pointed out in [26], empirical methods are almost always applied, relying on the outputs of MCMC samplers and diagnostics computed from the produced sequence to check convergence.

All of the sequences exactly corresponded to the original COI sequence of the proper primer set and none of the species-specific primer sets produced sequence that had errors (subpeaks, weak sequence, etc).

Plasmid DNA was isolated and sequenced using a primer with the sequence 5'CATGCAAGCTTCAGGGTTGAG 3' that anneals to the 3' end of the aphA3 gene and produced sequence of the flanking chromosomal DNA.

They've produced sequences for Wolverine, The Great Gatsby, and the new Paul Feig Ghostbusters reboot.

They've produced sequences for Wolverine, The Great Gatsby, and the new Paul Feig Ghostbusters reboot.

BLASTn searches were applied to all produced sequences using the available online databases (i.e. GenBank, EMBL).

In the present study we showed that treatment with AS Bcl-2 and AS Bcl-xL ODNs produced sequence-specific decreases in protein levels, thereby enhancing the chemosensitivity of BT-474, ZR-75-1, and MDA-MB-231 breast cancer cells to various anticancer drugs both in vitro and in vivo.

All produced sequences are deposited at the.