Sentence examples for produced sequence from inspiring English sources

Suggestions(1)

Exact(23)

It also produced sequence changes at one or both of the 5′ and 3′ termini of half the sequences.

Through advancements in the fields of molecular biology and technical engineering, parallelization of the sequencing reaction has profoundly increased the total number of produced sequence reads per run.

The proposed scheme may have a negative impact on the randomness of the produced sequence since the FF code is highly structured.

Therefore, as pointed out in [26], empirical methods are almost always applied, relying on the outputs of MCMC samplers and diagnostics computed from the produced sequence to check convergence.

All of the sequences exactly corresponded to the original COI sequence of the proper primer set and none of the species-specific primer sets produced sequence that had errors (subpeaks, weak sequence, etc).

Plasmid DNA was isolated and sequenced using a primer with the sequence 5'CATGCAAGCTTCAGGGTTGAG 3' that anneals to the 3' end of the aphA3 gene and produced sequence of the flanking chromosomal DNA.

Show more...

Similar(37)

They've produced sequences for Wolverine, The Great Gatsby, and the new Paul Feig Ghostbusters reboot.

They've produced sequences for Wolverine, The Great Gatsby, and the new Paul Feig Ghostbusters reboot.

BLASTn searches were applied to all produced sequences using the available online databases (i.e. GenBank, EMBL).

In the present study we showed that treatment with AS Bcl-2 and AS Bcl-xL ODNs produced sequence-specific decreases in protein levels, thereby enhancing the chemosensitivity of BT-474, ZR-75-1, and MDA-MB-231 breast cancer cells to various anticancer drugs both in vitro and in vivo.

All produced sequences are deposited at the.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: