Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
The FCC's set-top box proceeding is designed to enable consumers to watch the cable content they already pay for on the device (or app) of their choosing.
Similar(58)
The Nuvola® system is designed to proceed through consecutive steps of a maximum of 12 aligners.
It is designed to proceed in the following manner: in the first run of WildSpan, the sequence of median length is selected from the input set as the query sequence.
As a first step, we proceed with a very simple model that is designed to capture the basic institutional aspects of the problem and the most important sources of uncertainty faced by both employees and the unemployed.
An example for a questionable proceeding is designing an experiment with high concentrations causing high effects and extrapolating the obtained data to the low effect situation.
Because the assembly was designed to proceed in a branched fashion, the assembly of the three independent branches is not synchronized.
Because all of the steps of EPL are designed to proceed in the presence of high salt concentrations, this approach avoids the technical hurdle caused by the decrease in the solubility of polyarginine fusion proteins when expressed in E. coli.
New primers were designed to proceed restriction endonuclease reaction (EGFR Sense: 5′CATGAGTACGTATTTTGAAACTC3′; and Anti-sense: 5′CACACACCAGTTGAGCAGGTA3′) and the PCR reaction was performed as follows: 25 ng of genomic DNA, 1X PCR buffer (Invitrogen, USA), 3 mM MgCl2 (Invitrogen, USA), 0.2 mM dNTPs, 0.5 U of GoTaq Polymerase (Promega, USA), 3 pmol of each primer up to 25 μL.
PCR amplification and cloning of cDNAs proceeded as follows: PCR oligonucleotides pairs were designed to amplify the entire (or partial) cDNAs without start and stop codons to optimize expression from pTrcHis2 (Invitrogen), and to fuse the C-termini to a c-myc epitope and 6X-His tags within the vector.
The course was designed to be completed in three months and students could proceed at their own pace.
When you click "Run Cleaner" a message will pop up saying "This process will permanently delete files from your system, do you want to proceed?" CCleaner is designed in such a way that by default it only targets files that the average user would not even notice are gone.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com