An example for a questionable proceeding is designing an experiment with high concentrations causing high effects and extrapolating the obtained data to the low effect situation.
When you click "Run Cleaner" a message will pop up saying "This process will permanently delete files from your system, do you want to proceed?" CCleaner is designed in such a way that by default it only targets files that the average user would not even notice are gone.
The Nuvola® system is designed to proceed through consecutive steps of a maximum of 12 aligners.
It is designed to proceed in the following manner: in the first run of WildSpan, the sequence of median length is selected from the input set as the query sequence.
What if the network is designed so that if Mr. bin Laden were removed, the network would proceed unimpeded?
The first step was suggested performing at a moderate temperature for a shorter time to obtain liquid product with high furan content, while the second step was designed proceeding at a higher temperature for a comparatively longer time to produce more phenol compounds.
In order to conduct appropriate verification dedicated system with the ability to proceed walk-forward testing was designed and developed.
Because the assembly was designed to proceed in a branched fashion, the assembly of the three independent branches is not synchronized.
Because all of the steps of EPL are designed to proceed in the presence of high salt concentrations, this approach avoids the technical hurdle caused by the decrease in the solubility of polyarginine fusion proteins when expressed in E. coli.
New primers were designed to proceed restriction endonuclease reaction (EGFR Sense: 5′CATGAGTACGTATTTTGAAACTC3′; and Anti-sense: 5′CACACACCAGTTGAGCAGGTA3′) and the PCR reaction was performed as follows: 25 ng of genomic DNA, 1X PCR buffer (Invitrogen, USA), 3 mM MgCl2 (Invitrogen, USA), 0.2 mM dNTPs, 0.5 U of GoTaq Polymerase (Promega, USA), 3 pmol of each primer up to 25 μL.
