Sentence examples for procedures were run from inspiring English sources

ALD procedures were run at substrate temperatures of 150, 200, 250, 300, and 350°C, respectively.

ALD procedures were run at substrate temperatures of 150°C, 200°C, 250°C, 300°C, and 350°C, respectively.

Each PEEP step procedures were run three times, and the average of these runs was used as the result for a PEEP step.

Cerium oxide (CeO2) thin films used liquid injection atomic layer deposition (ALD) for deposition and ALD procedures were run at substrate temperatures of 150°C, 200°C, 250°C, 300°C, and 350°C, respectively.

Validation procedures were run to ensure that these data were appropriate for Canada.

The instrument was normalized, and the analysis procedures were run in duplicate for twice.

The with following procedures was run on the PCR system: denatured at 95° for 15 min, followed by 40 cycles at 95° for 30 sec, 55−60° for 30 sec, 72° for 30 sec, then extended at 72° for 10 min. The housekeeping gene GAPDH (forward: GAGGGTAGTGAAGGCTGCTG; reverse: ACCAGGAAACAAGCTTGACG) was used to normalize the loading amount of cDNA.

Blanks, which corresponded to analyses of coating fibres that were not submitted to any extraction procedure, were run between sets of three analyses.

Fractions from different steps of the purification procedure were run on a denaturing SDS-PAGE gel (Mini-PROTEAN TGX Precast Gels; Bio-Rad), using a transparent sample buffer (250 mM Tris pH 6.8, 20 % glycerol, 2 % SDS, 1 mM DTT).

Some procedures require knowing some bits of information that change how the procedure is run.

The 'X' in the Class suggests that this file is temporary and identifies it as scrap when the UVCLEANUP procedure is run.