Sentence examples for problems of mutation from inspiring English sources

Exact(1)

They are concerned that our findings of an unexpected high percentage of heterogeneity reflect methodical problems of mutation detection rather than tumour biology.

Similar(59)

There's the problem of mutation and escape from protection from one vaccine, a whole series of things that will maintain infectious diseases as a problem, but hopefully in developing countries not the problem that it is today where over a third of the population dies from infectious disease.

This representation solves the sparsity problem of mutation data and achieves reduced sensitivity to heterogeneous factors; it also enables genome-based real-time search for similar patients.

To avoid the problem of mutation saturation, we first estimated the divergence rate at 1st and 2nd positions using C. hamatus as above and an appropriate model estimated by the MODELTEST.

Primer design can partially compensate for the problem of mutations by specifically designing primers to target small point mutations and large deletions but that requires knowing the sequences of these mutations.

However, there are some limitations with the classical genetic mutant approach due to problems of compensatory mutations and with the reductionist approach of looking at one gene at a time.

Several recent computational studies have addressed the problem of optimum mutation rate.

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.

A dramatic illustration of the problem of passenger mutations recently reemerged when Casp1-null mice were found to carry an inactivating passenger mutation in the neighboring Casp11 gene (Kayagaki et al. 2011).

With respect to potential problems with milk production of mutation carriers, there has been one report indicating that this could be true [ 16].

In this elegant book Roger Sansom makes a very strong case that his novel approach to gene regulation is the key to solving the long standing problem of how mutations can lead to adaptive complexity in organisms.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: