Your English writing platform
Free sign upExact(3)
One of the most problematic findings of the survey for Saudi Arabia is the number of reported repeat attacks.
Such potentially problematic findings could include an individual's risk of certain cancers, her chance of passing on a deadly disease to her children, or a chromosomal abnormality that could cause infertility.
As with ordinary biomaterials, for which International Standards Organization (ISO) and other standards are already available, it is reasonable to commence clinical application of CNTs biomaterials, provided that no problematic findings are obtained from assessments in small animals.
Similar(56)
Another problematic finding is the high repeat content in exons of D. melanogaster of the two very similar repeat types with the unit AAACCAACTGAGGGAACGAGTGCCAAGCCTACAACTTTG (195.4 bp/Mbp) and AAACCAACTGAGGGAACTACGGCGAAGCCTACAACTTTG (109.1 bp/Mbp) with no contribution of these repeat types neither to CDS or UTRs, hinting at a problem in the annotation where these repeats occur.
Although inter-study comparisons are problematic, the findings of an overall response rate of 70% in the response evaluable population and a median progression free survival of 12.4 months in the present study are in line with the findings in studies using carboplatin in combination with either paclitaxel or pegylated liposomal doxorubicin in second line treatment of ovarian cancer [ 4, 18, 22].
All three subjects exhibited a decrease in the average number of problematic word finding behaviors from initial baseline to posttreatment measurement.
One too many big lies can be problematic for finding "the one".
The only other composite with a problematic psychometric finding was Supervisor/Manager Expectations & Actions Promoting Patient Safety in which the hospital-level model fit was lower than the cutoff of.90 (CFI =.82).
While interpretations of increased and decreased activity in patient groups can be problematic, this finding at least argues against the possibility that the slower RT in subjects with BD-I resulted from poor task engagement.
Whilst health professionals may wish to avoid conflict during consultations and find the application of recent research findings problematic [ 22].
This is potentially problematic, because our findings suggested that measures of physical functioning differ in their sensitivity to cognitive change, a result that many investigators acknowledged.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com