Exact(1)
Another problematic finding is the high repeat content in exons of D. melanogaster of the two very similar repeat types with the unit AAACCAACTGAGGGAACGAGTGCCAAGCCTACAACTTTG (195.4 bp/Mbp) and AAACCAACTGAGGGAACTACGGCGAAGCCTACAACTTTG (109.1 bp/Mbp) with no contribution of these repeat types neither to CDS or UTRs, hinting at a problem in the annotation where these repeats occur.
Similar(59)
One of the most problematic findings of the survey for Saudi Arabia is the number of reported repeat attacks.
Such potentially problematic findings could include an individual's risk of certain cancers, her chance of passing on a deadly disease to her children, or a chromosomal abnormality that could cause infertility.
As with ordinary biomaterials, for which International Standards Organization (ISO) and other standards are already available, it is reasonable to commence clinical application of CNTs biomaterials, provided that no problematic findings are obtained from assessments in small animals.
All three subjects exhibited a decrease in the average number of problematic word finding behaviors from initial baseline to posttreatment measurement.
One too many big lies can be problematic for finding "the one".
While interpretations of increased and decreased activity in patient groups can be problematic, this finding at least argues against the possibility that the slower RT in subjects with BD-I resulted from poor task engagement.
Questions may be motivated not only by the purely cognitive interest of curiosity, but by various practical interests in understanding the nature and causes of situations one judges to be problematic, and in finding out how to improve those situations.
Also problematic is the finding that older adults do not only recruit RH frontal regions but also MTG regions.
Finding that special person who is able to be counted upon during problematic times is like finding a diamond on the beach.
In Table 2, frequencies of sickness certification consultations and of finding them problematic as well as to what extent the handling of sickness certification was perceived as problematic are presented by sex, age, and specialist status.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com