Sentence examples for problem of mutation from inspiring English sources

This representation solves the sparsity problem of mutation data and achieves reduced sensitivity to heterogeneous factors; it also enables genome-based real-time search for similar patients.

To avoid the problem of mutation saturation, we first estimated the divergence rate at 1st and 2nd positions using C. hamatus as above and an appropriate model estimated by the MODELTEST.

Primer design can partially compensate for the problem of mutations by specifically designing primers to target small point mutations and large deletions but that requires knowing the sequences of these mutations.

They are concerned that our findings of an unexpected high percentage of heterogeneity reflect methodical problems of mutation detection rather than tumour biology.

Several recent computational studies have addressed the problem of optimum mutation rate.

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.

A dramatic illustration of the problem of passenger mutations recently reemerged when Casp1-null mice were found to carry an inactivating passenger mutation in the neighboring Casp11 gene (Kayagaki et al. 2011).

DECAAF has been applied to the problem of identifying mutations in LesB based on the active site of LesA in order to endow LesB with tributyrin hydrolysis.

This and many other examples (including those described in the paper) suggest that the problem of dominant mutations is extremely complex.

One group continued to ignore the problem of background mutations, often reporting inexact or obscure citation of the strain name, or burying its identity in a chain of references to the previous papers.

In this article, we address the problem of screening mutations that affect protein thermostability and develop a novel method able to sort out thermostable protein variants at the sequence level.