Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.
Similar(59)
However, xylose utilization was not complete and the adapted strain cell viability fell near the end of glucose consumption/beginning of xylose uptake, suggesting a potential problem combating deleterious impacts of ethanol and inhibitors from the 12% glucan AFEX CSH feed while trying to metabolize the xylose.
To circumvent the problem of unequal levels of slightly deleterious polymorphisms present in genes of different LS groups, we used two related procedures: 1) removing all SNPs whose derived alleles are at low frequencies (derived allele frequency [DAF] < 0.15) and 2) subsampling nSNPs at low frequencies (DAF < 0.15), such that SFS distributions across all LS classes match each other.
Haploid organisms such as prokaryotes do not have this problem of keeping their genome from accumulating deleterious mutations, because in haploids, all mutations are dominant, and deleterious ones will hence be eliminated very rapidly.
Intimate partner violence (IPV) is a common, serious problem with deleterious impacts on the health of women.
Then it was the turn of deleterious mutations, which became trendy in the late 1980s and early 1990s.
There are lots of deleterious effects of these open-plan offices.
We used the DFE method to quantify the proportions of deleterious mutations.
Maisnier-Patin, S. et al. Genomic buffering mitigates the effects of deleterious mutations in bacteria.
Charlesworth, B., Morgan, M.T. & Charlesworth, D. The effect of deleterious mutations on neutral molecular variation.
Prevalence of deleterious ATM germline mutations in gastric cancer patients.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com