Sentence examples for probe forward from inspiring English sources

Probe, forward and reverse primer sequences were 5′-Fam-TTC AAG TCC GCC ATG CCC GAA-Tamra-3′, 5′-AGT GCT TCA GCC GCT ACC-3′, 5′-GAA GAT GGT GCG CTC CTG-3′ respectively.

Lindner's driving piano and synthesizer and Lefebvre pulsing bass work in lock step to produce the firm rhythmic background that allows these two seemingly unstoppable forces to probe forward into the abyss.

The hybridization probe was generated by PCR amplification with the following primers: HYB probe reverse, 5'-TCCTTCTGCCAAATCCCGTTATGC-3', HYB probe forward, 5'-CAAAACTCAAAGTAGAAAGAACAAGG-3' using 129/svJ mouse genomic DNA as a template.

Quantification of β-actin cDNA was performed with a Taqman PCR master mix (Applied Biosystems) using the following set of primers and probe: forward primer (5'CACCTGAGCGCAAGTACTCTG -3'), reverse primer (5' TCTGCTGGandGTaqManG-3'), and TaqMan probe (5'TGGAGGCTCTATCCTGGCCTCCC-3').

Real time polymerase chain reaction (PCR) diagnostics for S. suis serotype 2 with cps2J as gene target (primers and probe: forward GGTTACTTGCTACTTTTGATGGAAATT, reverse CGCACCTCTTTTATCTCTTCCAA, probe FAM-TCAAGAATCTGAGCTGCAAAAGTGTCAAATTGA-TAMRA) were implemented according to a previously described method [2].

Gene expression analysis of the HCV genome was performed using the LightCycler® FastStart DNA Master HybProbe system (Roche Applied Science) with the following primer set and probe: forward primer, 5'-CGGGAGAGCCATAGTGG-3' and reverse primer, 5'-AGTACCACAAGGCCTTTCG-3', and the fluorogenic probe, 5'-CTGCGGAACCGGTGAGTACAC-3'.

Within seconds Armenia have the ball and are probing forward.

After generations of being an adventurous, exploratory music always probing forward -- an avant-garde art of the American street -- jazz flipped backward, focusing on its past.

This did not change the situation around Sattelberg as by then the Australians had reached its southern slopes and the following day they began probing forward towards its summit.

Advancing beneath the supporting barrage, under the direction of their officers whose job it was to ensure that they did not get ahead of the creeping artillery, the battalion probed forward trying to locate the enemy defences, finally finding an abandoned trench located amongst a group of tree stumps.

VEGF mRNA levels were measured by RT-PCR (TAQMAN) on the ABI Prism® 7900HT Sequence Detection System (Applied Biosystems) using specific primers and probes (forward primer: 5'-CCAGCACATAGGAGAGATGAGCTT-3', reverse primer: 5'-CGCCTCGGCTTGTCACA-3', probe: 6-FAM-5'-ACAGCACAACAAATGTGAATGCAGACCAAA-3'-TAMRA).