Sentence examples for probe chip from inspiring English sources

This study designs a CMOS-MEMS probe chip and fabricates it using the 0.35 μm CMOS process of the Taiwan Semiconductor Manufacturing Company (TSMC).

The probe chip has a through-silicon-via (TSV) package structure combination with the multi-layer interconnections within CMOS processes, which simplifies the wiring layout and improves the connectivity between the probe heads and external devices.

Its products include nozzle plate, multi-electronics probe chip, bio-probe, MEMS vertical probe card, deoxyribonucleic acid inspection chip, ink jet and silicon micro process.

CGH was performed using the Agilent 44 K oligonucleotide probe chip (Agilent Technologies, Waldbronn, Germany; mean spacing: 22.3 kb, median spacing: 13.1 kb).

In order to probe ChIP DNA for AR binding sites in the PSA gene, ChIP DNA was subjected to PCR using primers for PSA ARE III: 5'- cttctagggtgaccagagcag (forward) and 5'- gcaggcatccttg-caagatg (reverse).

The practical experience has shown that all control cycles on the probe chips operate accurately.

Because collagen fibrils are cylindrical, the width was likely influenced by the shape of the probing chip.

Kandimalla et al. used an Agilent CpG island array in 44 UC vs. blood for discovery and a custom Goldengate 384-probe chip for validation in an independent set of tumors vs. normal urine.

Standard NimbleGen probes were also placed on the array, including alignment probes, chip identification probes, and random cDNA probes designed to match the content of our user designed probes.

Further the nature of microarray based datasets can suffer from lab specific variability, probe variability, chip to chip variation and sample preparation(s) required for each experiment.

Topics include magnetic resonance spectroscopy, microelectrodes, fluorescent probes, chip-based biosensors, X-ray and electron tomography, and MRI.