Your English writing platform
Discover LudwigSuggestions(1)
Exact(19)
The intron in punch was obtained with a forward B. betularia-specific primer within partial cds from the transcriptome and a degenerate reverse primer within the next exon.
A 6-FAM-labeled internal primer within the Vβ PCR products (Cβ2 derived from β chain constant region) was synthesized by Applied Biosystems (Foster, CA).
Alignment of sequences to the PEST genome using the Blast algorithm [13] allowed the other flanking sequence to be confirmed by genomic PCR using one primer within the transgene and a second designed to the adjacent PEST genome.
For genotyping Hi-MYC mice, the upstream primer (located within the ARR2-PB promoter), 5'AAACATGATGACTACCAAGCTTGGC-3' and the downstream primer (within the MYC cDNA sequence) 5'ATGATAGCATCTTGTTCTTAGTCTTTTTCTTAATAGGG-3' were used to generate a PCR product of 177 base pairs.
To identify transposon insertion sites, mutant genomic DNA was isolated (Purgene) and fragments adjacent to egfp were cloned by arbitrary PCR [20] with a specific primer within the egfp gene, ArbC (GGCCACGCGTCGACTAGTAC) and arbitrary primers Arb1 (GGCCACGCGTCGACTAGTACNNNNNNNNNNGAT) and Arb6 (GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC).
We carried out PCR from cDNA of several tissues using a forward primer located in exon 6a and a reverse primer within the conserved region spanning a genomic distance of 4193 bp.
Similar(41)
To minimize the amplification of hamster DNA contained within the RH panel cell lines, primer pairs were designed with one primer within exon, the other within the adjacent intron or non-coding sequence.
This was done to exclude remaining primers and primer dimers within the samples as the small molecular weight DNAs are preferentially bound and amplified during emPCR.
To determine whether in each of the VPaI-1-positve strains the chromosomal insertion site was identical, a primer pair was designed which comprised of a forward primer within VP0379, the 5' core VPaI-1 flanking gene, and a reverse primer within VP0380, the first gene within the island.
Prospective primers for each region are paired with all other primers within the existing pool and the most negative ΔG-based dimer score of all these interactions is recorded.
The locations of the primers within the respective plasmids are depicted in Fig. 1.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com