Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
cDNA libraries were constructed with the SMART cDNA Library Construction kit (Clontech, Mountain View, CA, USA), using a modified primer to include a Sfi I enzyme restriction site.
Similar(59)
Apart from the design of new R1_Promoter and F2 primers to include the promoter, all other construction steps were the same as for the promoterless constructs.
The APL1B transcript was determined by designing primers to include all possible upstream start and downstream stop codons and screening for PCR amplification.
Since detection, especially in tick vectors, is usually based on PCR with genus-specific primers to include different occurring Rickettsia species, subsequent species identification is mainly achieved by Sanger sequencing.
For PCR amplification of each gene of interest, forward primers were designed to include the attB1 site (ggggacaagtttgtacaaaaaagcaggcttg and the first 20 bp of the gene, and reverse primers to include the attB2 site (ggggaccactttgtacaagaaagctgggtc) and the last 20 bp of the gene, excluding the stop codon.
Furthermore, PCR with an internal primer designed to include an allele-specific SNP at the 3′ end (site 443) showed differentiation between the two variants, 100%and4.2%2% amplification in green and red variants, respectively.
PCR was carried out after optimizing annealing temperatures for each primer set to include 40 timed cycles of denaturation at 94°C for 30 seconds, annealing for 30 seconds, and extension at 72°C for 30 seconds.
PCR products were generated by using primers designed to include ends of the gene that was excised as well as flanking regions of the gene.
Additional primers designed to include more of the psbA coding region and a portion of psbA-trnH intergenic spacer specific to either the small or large fragment (Table 3) were tested on Encephalartos nubimontanus.
All exons were amplified by PCR with primers designed to include intronic RNA splice donor and acceptor sites.
Selected full-length transcripts were then amplified using primers designed to include the putative start and stop codons.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com