Sentence examples for primer aligned to from inspiring English sources

We performed conventional PCR using a 5′ primer designed against the 5′ end of the corresponding IGF cDNA and a 3′ primer aligned to the 3′ UTR-polyadenylation signal sequence of the recombinant IGF, which differs from that of the naturally expressed IGF mRNA (see Materials and Methods).

PCR Primers were designed (where one primer aligned to flanking genomic DNA sequence and the other aligned to one end of the inversion, translocation, or divergent regions) using Primer 3 (http://frodo.wi.mit.edu/primer3/input.htm, last accessed December 16, 2013) incorporating a 1 bp C/G clamp and targeting a Tm of 60 °C.

Among the candidate clones, 2169 were completely sequenced only by using universal sequencing primers (forward and reverse primers aligned to the vector sequence, and T25V primer).

a Clones that were completely sequenced just by using universal primers (forward and reverse primers aligned to the vector sequence, and T25V primer).

To verify exons whose intron boundaries do not agree between two catalogs, one primer aligns to the overhanging region of each of the two partially aligned exons and the other primer aligns to a nearby exon that is exactly overlapping between the two catalogs.

In addition, fusion of Mbd5 mRNA of the trapped and the reporter gene was checked by RT PCR using an Mbd5-specific primer (p2: TCGGATCCTAACTAAATCAAAATG) and a primer aligning to the trap vector (pT: GTAATGGGATAGGTTACGTTGGTGTAG).

Clones predicted to contain the correct insert were sequenced from both ends of the expression construct using the BGH, T7 and pTandem1 Tandem DOWN1 primer and aligned to the GenBank mouse RNF14 sequence.

We found that both primer pairs aligned to the recruited metagenomics reads and would, in principle, amplify the corresponding regions from the original samples (supplementary fig. S4, Supplementary Material online).

The VVMD27 primer pair aligned to a unique position on the genome assembly and the end sequences of the BAC clones that carried VVMD27 aligned to the same single genomic region as well [see Figure 1B], showing that the apparent duplication in the physical contig corresponded to a single locus in the genome sequence.

In this study, fault tolerance is set to three in e-PCR pipeline Step 2 to remove multiple loci as much as possible and increase the probability of the unique primers being aligned to reads from samples, while fault tolerance is set to one in e-PCR pipeline Step 3, given the tradeoff between InDel accuracy and SNP tolerance.

To ensure that amplification by the cb18178 primer is not biased toward one mitotype, the primer sequences were aligned to the AF16 and HK104 mitochondrial genome assemblies.