Sentence examples for prime the reverse from inspiring English sources

Briefly, sRNA-specific primers (GSP1 primers) were used to prime the reverse transcription of RNA from strain MGAS2221 (Table S2).

To prime the reverse transcription (RT) reaction 3 µg of aRNA was incubated with 2 µL of 5 µg/µL random nonamers for 10 minutes at 70°C.

Oligo-dT was used to prime the reverse transcription.

Oligo-dT is commonly used to prime the reverse transcriptase reactions that generate cDNAs for EST library preparation.

Moreover, this division is perfectly correlated with the form of tRNA used to prime the reverse transcription.

Non-long terminal repeat (non-LTR) retrotransposons mobilise using a target-primed reverse transcription (TPRT) mechanism involving the use of the 3′ hydroxyl group at a DNA break to prime the reverse transcription of their RNAs [ 1].

First, a different oligonucleotide was used for priming the reverse transcription reaction: 5'AAGCAGTGGTATCAACGCAGAGTCGCAGTCGGTAC(T 13V (where V stands for a mixture of A, G, and C bases).

The former primes the reverse transcription of mRNA, while the latter is essentially a T7 promoter-containing GC-rich sequence that primes second strand cDNA synthesis.

Several mechanisms have been proposed to explain how false-priming may occur during the RT step, including self-priming of the reverse transcriptase from secondary hairpin structures present in highly folded viral RNA, and random-priming by short endogenous or exogenous nucleic acids [19], [20], [21].

For RT-PCR of Gag mRNA, a Gag-specific primer (Table S1, HV-12) was used for priming of the reverse transcriptase reaction.

Both oligo dT and random hexamers were used for priming of the reverse transcription reaction and Alexa Fluor® 555 and Alexa Fluor® 647 dyes (Invitrogen) were used for labelling.