Sentence examples for prevent amplification from inspiring English sources

Exact(60)

The primers for different targets were located on different exons to prevent amplification of genomic DNA.

RT-PCR primers were designed to span introns to prevent amplification of genomic DNA.

Primers: Jak2cDNAF2: CACATAGGAACTATTCAGAGTCTTTC; Jak2MutR3: AGAATGTTCTCCTCTCCACAGTA (additional mutations were added to the primer to prevent amplification of unmatching sequences).

The main lesions, pyrimidine-pyrimidine photoadducts prevent amplification since the Taq polymerase stalls at these lesions thus "neutralize" the DNA as a polymerase template.

To prevent amplification above the linear range, we added SYBR Green to the amplification reaction in order to monitor efficiency in real-time.

Briefly, genomic DNA was extracted from 0.5 5×106 infected cells and digested with MseI and a second enzyme to prevent amplification of internal 5' LTR fragments (PstI for RV vectors and SacI/NarI for LV vectors).

If breakdown of immunity contributes to selection for X4 variants, then immune-based strategies may delay or prevent amplification of X4-using viruses independent of the tissue of origin.

This was followed by digestion to prevent amplification of internal viral fragments (from the 5' LTR) and plasmid backbone with SacI and DpnI in the case on HIV, and XmaI and DpnI in the case of EIAV.

Primers were designed to span exon boundaries in order to prevent amplification of genomic DNA.

In addition, to prevent amplification of contaminating gDNA, the amplicon should cross exon-exon boundaries.

The PCR cycling conditions were set to 25 rounds to prevent amplification beyond the exponential phase.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: