Sentence examples for prepared forward from inspiring English sources

Exact(1)

3. (S/NF) In order to avoid the Indian Army's slow and lumbering military mobilization process and preserve the element of surprise in attack, Cold Start attacks could begin within 72 hours after the attack order has been given, and would be led by armored spearheads launched from prepared forward positions in Punjab and Rajasthan.

Similar(54)

Monodisperse surface-charged submicron polystyrene particles were designed, synthesized, and blended into polysulfone (PSF) support layer to prepare forward osmosis (FO) membrane with high performance.

Seized by the United States in World War II, they were prepared as forward bases for the invasion of Japan but were never used as such.

The comptroller, already anticipating that the mayor intended to override his objections, said yesterday he was prepared to forward his findings to other authorities for investigation.

The conventional PDA-decorated membrane (labeled as PES/PDA-F) prepared with forward filtration was used for comparison.

"I look at it more as not planning for any specific event, but more for the reality of the global situation we find ourselves in and how we ensure we're prepared going forward".

We also prepared unlabeled forward primers and mixed them with fluorescent ones.

Templates were prepared using forward primers that contained the T7 RNA polymerase promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA [T7]).

Japanese versions of these scales (Schwartz-J and Lipkus-J) were prepared using forward and backward translation procedures [ 25].

The Δ28/175TS caspase-3 mutant of plasmid IX was prepared using forward P3 and reverse P2 primers.

For each sample, the sequencing reactions were prepared with forward and reverse primers in a MegaBACE 1000 DNA System.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: