Sentence examples for prepare forward from inspiring English sources

Monodisperse surface-charged submicron polystyrene particles were designed, synthesized, and blended into polysulfone (PSF) support layer to prepare forward osmosis (FO) membrane with high performance.

It will prepare and forward to the Administration required reports.

Your advisor can help you think of what questions to ask and how you'll prepare going forward.

The PCR-Select cDNA Subtraction Kit (BD Biosciences, Oxford, UK) was subsequently used to prepare both forward and reverse subtracted libraries from each tissue.

The conventional PDA-decorated membrane (labeled as PES/PDA-F) prepared with forward filtration was used for comparison.

The comptroller, already anticipating that the mayor intended to override his objections, said yesterday he was prepared to forward his findings to other authorities for investigation.

"I look at it more as not planning for any specific event, but more for the reality of the global situation we find ourselves in and how we ensure we're prepared going forward".

We also prepared unlabeled forward primers and mixed them with fluorescent ones.

Templates were prepared using forward primers that contained the T7 RNA polymerase promoter sequence (CCAAGCTTCTAATACGACTCACTATAGGGAGA [T7]).

Japanese versions of these scales (Schwartz-J and Lipkus-J) were prepared using forward and backward translation procedures [ 25].

The Δ28/175TS caspase-3 mutant of plasmid IX was prepared using forward P3 and reverse P2 primers.