Sentence examples for preparation generated from inspiring English sources

We believe that variable levels of different N-termini in each preparation, generated through the purification process or by bacterial proteases may explain potency differences in these and other laboratories' preparations.

However, subsequent RT-PCR assays (at IAH) using two sets of experimental primers targeting Seg-2 from each of the BTV serotypes (1 to 25) (Mertens et al., [80] and manuscript in preparation), generated cDNA amplicons of the expected sizes from two of the three blood samples (Heeten and Barchem), but only with the BTV-6 specific primers.

Proteomic analysis of Connaught Tuberculin 68 (PPD-CT68), a tuberculin preparation generated from M. tuberculosis, was carried out in this study.

The central question is whether differences in sample preparation generated distinct MAVS filaments with different physical structures, or whether the differences in the reported structures instead reflect methodological problems in the Xu et al study.

The reagent preparation generates a lot of acid fumes, therefore the flask top must be firmly set and clamped in place and a gas wash flask attached to the outlet.

To activate neurons in layer 4, we used trains of thalamic stimuli (4 8 stimuli, 40 Hz, 25 100 µA) (Figure 1a and 1b), which, in this preparation, generates reverberant cortical activity (Figure 1c), in contrast to low frequency stimulation (<10 Hz), which activates very few cells [16].

Administration of this modified-release preparation generates a plasma cortisol profile that mimics the natural diurnal pattern of circulating cortisol, except for the early morning increase in cortisol that occurs during sleep [ 25].

Additionally, the clinical scenario has shown superior effectiveness for the alcohol-based handrub preparation, due to the higher in vitro microbial counting of 23% than its comparator In the ecological scenario, the reduction of 18,5 liters of water per procedure with the use of alcohol-based handrub preparation generates cost savings besides the saving in the water consumption itself.

For generation of the parS-359-specific Southern probe a PCR with primers annealing within and downstream of the parB locus ('STG301': acatgagaattcgttttttcatttatgattctcgttcagacaaaagctc and 'STK534': gcaatctgcagcatggcattcttcag) was performed on a wild-type genomic DNA preparation generating a 714 bp long PCR product.

Nonetheless, a list of control genes for RNA preparations generated by two commercial vendors (Qiagen and Superarray Bioscience) was used for this test (Table S3 and Figure S2).

For all preparations generated in M. tuberculosis, protein-containing samples were checked for sterility using viability assays prior to removing from the BSL3 laboratory.