Sentence examples for preparation efficiency from inspiring English sources

Exact(8)

This method has many advantages such as preparation efficiency, high productivity, and few by-products.

More importantly, the usage of excess DBA small linkers could significantly enhance the preparation efficiency of cyclic polymers.

The latter reaches the unitary bound on TQC preparation efficiency starting from thermal equilibrium in AX2 systems, not considering relaxation.

In consideration of the high preparation efficiency, high capacitance and simple preparation method, this (Co, Mn 3O4 nanogranule electrode has great potential applications in supercapacitor.

By comparing above mass with that of the original EGF-FITC quantity added during liposome preparation, efficiency of encapsulation was calculated as 67% (Supporting Information, Figure S2b).

Samples were spiked with three synthetic pre-labelling control RNAs (3 fmol per sample; pCAGUCAGUCAGUCAGUCAGUCAG, pGACCUCCAUGUAAACGUACAA, and pUUGCAGAUAACUGGUACAAG; Dharmacon, Chicago, IL, USA) to monitor target preparation efficiency.

Show more...

Similar(52)

To control for differences in sampling, DNA preparation, reaction efficiency (the varying PCR efficiencies between patient samples and the calibrator) [ 39] and other variables such as the Ct values for each primer pair [ 40] from 22q11.2 were corrected/normalized using the Ct value of the G6PDH and HEM3 products for the same sample.

Interestingly, when increasing the PTX feed/POx ratio in the drug polymer film during preparation, the efficiency of P1 to solubilize PTX was initially similar to that of P2, but dropped sharply above a ratio of 1 5 (w/w).

The preparation, loading efficiencies, release kinetics, cytotoxicity and in vivo behaviour of these systems is discussed in detail.

Important advantageous properties of adenoviral vectors include: feasible production of high-titer vector preparations, high efficiency in transducing both quiescent and actively dividing cells, high levels of transient gene expression, and a lack of mutagenic properties associated with integrating vectors.

Typically, shake flasks (SFs) are used for screening both pretreated biomass for enzyme digestibility and enzyme preparations for efficiency and effectiveness in digesting biomass at the National Renewable Energy Laboratory NRELL) and elsewhere.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: