Sentence examples for predicting start from inspiring English sources

Different types of prediction error were considered, such as excluding coding exons, including introns as part of the coding sequence, or wrongly predicting start and termination sites.

In the RBS prediction model, upstream sequences of the predicted start codons (in the previous step) range from −3 to −19 were used for model construction and prediction.

Figures  4a&b show the positional biases from the peak start and end prediction, calculated as (true start genome location - predicted start genome address) and (true end genome address - predicted end genome address) respectively.

However, based on Verizon's various statements to investors, the plan was always to do a part of Verizon Boston with actual fiber to the home, and, as predicted, start tests with wireless--because it makes the company more profits.

The cloned NvFP-7R is missing 22bp from the predicted start codon.

Badly predicted start or stop sites are identified by considering the positions of the N/C-terminal residues for each sequence in the subfamily alignment (Figure 2B).

The cDNA starting at the predicted start codon was deposited in GenBank (AF355797).

It includes the SIPHT predicted start and stop positions as well as the predicted strand.

This underscores the value of a comparative genomics approach for post-processing predicted start sites.

Of 74,135 available ESTs, 3,129 had 5′ termini that mapped upstream of the predicted start codon.

HSM_1794 contains 4 copies of CAAGCCTACAAGCCTACAAGCCTA 262 bp upstream of the predicted start codon.