Sentence examples for precarious based on from inspiring English sources

Russia's robust growth is precarious, based on high prices for oil and gas that may not last and rising production that may not prove sustainable.

The close of the second world war ushered in a cold war, with a precarious peace based on the threat of mutually assured destruction.

I understand the precarious nature of voting based on one issue, but, as I said, I have pretty much always put my concern for equal rights and opportunities for all above all other election issues to a certain extent.

Peace is precarious unless it is based on justice and human dignity.”.

Government strategy has delayed a return to growth, which is still precarious as so much is based on a house price bubble and credit card loans.

Using primers based on the Precarious Point virus sequence, N and NS-s gene sequences were obtained from the rockhopper penguin-associated virus (EU274384).

Following the event, a field survey was conducted along the fault zone with the goal of estimating the peak ground acceleration of the shock based on visually evaluating precarious rock formations and other indicators.

The primer sequences for the phlebovirus were based on sequence from Precarious Point virus and were forward 5' GGCAGATGATGGACAGTGG 3' and reverse 5' GTCTGAGGAAGGCAAGAAGG 3' (annealing temperature 55°C).

Distinguishing between orthology and paralogy can be precarious when the assessment is only based on homology scores, and without an adequate phylogenetic landscape for each gene family involved [ 77].

But any recovery based on oil prices is precarious, he says.

The additional wage rate is based on the bonus for precarious work (temporary and subcontracted labour) on the French labour market [55, 56].