Sentence examples for precarious based from inspiring English sources

Russia's robust growth is precarious, based on high prices for oil and gas that may not last and rising production that may not prove sustainable.

From a precarious base where his noble origins would not protect him from life's hazards, he worked consistently for a single end: a unified Greece which might, however improbably, serve as an inspiration to the rest of Europe.More than his fellow philhellenes, Byron seems to have empathised with his Greek associates.

The close of the second world war ushered in a cold war, with a precarious peace based on the threat of mutually assured destruction.

Peace is precarious unless it is based on justice and human dignity.”.

I understand the precarious nature of voting based on one issue, but, as I said, I have pretty much always put my concern for equal rights and opportunities for all above all other election issues to a certain extent.

Government strategy has delayed a return to growth, which is still precarious as so much is based on a house price bubble and credit card loans.

Using primers based on the Precarious Point virus sequence, N and NS-s gene sequences were obtained from the rockhopper penguin-associated virus (EU274384).

Meanwhile, tumbling stockmarkets put added strain on precarious capital bases.Eifuku Master Fund, a $300m Japanese hedge fund, collapsed.

The precarious Allied bases were poorly situated, which caused supply and shelter problems.

Following the event, a field survey was conducted along the fault zone with the goal of estimating the peak ground acceleration of the shock based on visually evaluating precarious rock formations and other indicators.

The primer sequences for the phlebovirus were based on sequence from Precarious Point virus and were forward 5' GGCAGATGATGGACAGTGG 3' and reverse 5' GTCTGAGGAAGGCAAGAAGG 3' (annealing temperature 55°C).