Although 15 of these identical orthologs also contained identical signal and pre regions (dN = dS = 0), six gene pairs had 1 10 amino acid differences in the prepro regions.
One variation was found in pri-miR-29a, three variations were detected in pre-miRNA region (pre-miR-16-1, pre-miR-372, pre-miR-106b) and one variation was found in the mature miR-142-3p miR-142-3p miR-142-3p
The pre-pro-region consists of a pre-region (coding for19 amino acids) and a pro-region (coding for 13 amino acids).
The Asiatic honeybee hymenoptaecin precursor gene is made up of three parts: a pre-region (coding for 17 amino acids), a pro-region (coding for 16 amino acids) and a mature region (coding for 93 amino acids).
The Asiatic honeybee abaecin precursor gene is made up of two parts: a pre-region (coding 19 amino acids) and a mature region (coding 33 or 34 amino acids).
In total, 22 NS and 48 SS exist in the 11 precursor genes, 3 NS and 6 SS in the pre-region and 4 NS and 10 SS in the mature region.
The Asiatic honeybee defensin precursor gene is composed of three parts: a pre-region or signal region (coding 18 or 19 amino acids), a pro-region (between signal and mature region, coding 24 amino acids) and a mature region (coding 52 amino acids) (Figure 2).
The Y. lipolytica secretion vector (pYLSC1, 7205 bp) contains the hybrid promoter (hp4d) and a secretion signal (XPR2 pre-region): atgaagctcgctaccgcctttactattctcacggccgttctggcc, which encoded signal peptide MKLATAFTILTAVLA.
The pre-region is responsible for directing the nascent protein post-translationally into the endoplasmic reticulum (ER) and is cleaved off subsequently by signal peptidase (Waters et al. 1988).
