Suggestions(1)
Exact(2)
Targeting sequences are shown: Pre region underlined and X-Ala sequences in bold.
Conopeptides are genetically encoded small proteins that are initially translated as prepropeptide precursors consisting of a signal sequence (the "pre" region) followed by a "pro" region, and at the C-terminal part representing the mature toxin region.
Similar(58)
Although 15 of these identical orthologs also contained identical signal and pre regions (dN = dS = 0), six gene pairs had 1 10 amino acid differences in the prepro regions.
One variation was found in pri-miR-29a, three variations were detected in pre-miRNA region (pre-miR-16-1, pre-miR-372, pre-miR-106b) and one variation was found in the mature miR-142-3p miR-142-3p miR-142-3p
The pre-pro-region consists of a pre-region (coding for19 amino acids) and a pro-region (coding for 13 amino acids).
The Asiatic honeybee hymenoptaecin precursor gene is made up of three parts: a pre-region (coding for 17 amino acids), a pro-region (coding for 16 amino acids) and a mature region (coding for 93 amino acids).
The Asiatic honeybee abaecin precursor gene is made up of two parts: a pre-region (coding 19 amino acids) and a mature region (coding 33 or 34 amino acids).
In total, 22 NS and 48 SS exist in the 11 precursor genes, 3 NS and 6 SS in the pre-region and 4 NS and 10 SS in the mature region.
The Asiatic honeybee defensin precursor gene is composed of three parts: a pre-region or signal region (coding 18 or 19 amino acids), a pro-region (between signal and mature region, coding 24 amino acids) and a mature region (coding 52 amino acids) (Figure 2).
The Y. lipolytica secretion vector (pYLSC1, 7205 bp) contains the hybrid promoter (hp4d) and a secretion signal (XPR2 pre-region): atgaagctcgctaccgcctttactattctcacggccgttctggcc, which encoded signal peptide MKLATAFTILTAVLA.
The pre-region is responsible for directing the nascent protein post-translationally into the endoplasmic reticulum (ER) and is cleaved off subsequently by signal peptidase (Waters et al. 1988).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com