Your English writing platform
Discover LudwigExact(6)
"Avengers did staggering business for sure: it was perfectly positioned at the start of the summer, so hats off to them.
Finally, we found that a simple heuristic could provide key-frames that are positioned at the start of each interesting video segment.
Fittingly positioned at the start of New York Fashion Week, two William Klein (b. 1928) fashion images slid onto the auction block on Sept. 8.
Factor Xa is an attractive target as it is positioned at the start of the common pathway of coagulation.
Using a forward primer positioned at the end of the duplication (TCTCTGTTGGATGGAGCTTCT) and a reverse primer positioned at the start of the duplication (CGATGTAAAAAGACACAAGAGAAA), we successfully PCR-amplified this unique region in a carrier sample.
In a sequence s i with z i = 1, a K-mer motif is positioned at the start site u i ∈ { 1, …, L i − K + 1, L i + 1, …, 2 L i − K + 1 }.
Similar(54)
Throughout the experiment, dry bulb, wet bulb, and globe temperatures were measured every 30 min using a portable climate monitoring device (Davis instruments inc., Hayward, USA) positioned at the start/finish area.
Then we positioned ourselves at the start line, he on the left side of the sled and I behind it.
In P. falciparum, we observed the most strongly positioned nucleosomes at the start and the end of coding regions, with less tightly organized nucleosomes in the gene body.
Although all but one of the races were short by our standards, the runners' position at the start was unlike the four-point starting crouch assumed by modern sprinters.
Specific mRNAs bypass the linear ribosome scanning process by directly recruiting the ribosome and positioning it at the start codon through internal ribosome entry site (IRES) sequences.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com