Sentence examples for position the sequence from inspiring English sources

For sequences with large kcat (those with serine (S), glycine (G), or alanine (A) in the P1′ position), the sequence with lowest KM (the serine sequence) exhibited highest background.

The electrostatic potential of a residue is defined as the average of the electrostatic potentials at the locations of all its atoms as described in Jones et a. [ 1]; (3) Sequence entropy at each residue position (the sequence entropy for the corresponding column in the multiple sequence alignment) was extracted from the HSSP database [ 20].

"Although each bag is mounted in a stationary position, the sequences of inflation and deflation create the impression of lively movements.

For each element identified in orthologous position, the sequences of O. sativa and O. glaberrima were aligned using ClustalX.

MAQ successfully positions the sequence assembly on the reference genome.

TopHat first positions the sequence on the reference genome using Bowtie.

For each training trial, the rat was put into the pool at one of the five positions, the sequence of the positions being selected randomly.

For each trail, each rat was put into the water at one of four starting positions, the sequence of which being selected randomly.

This is determined from the information content at each position in the sequence, summed over all positions.

We used bolting primers CGCCAACTGTACACTCGTATT (upstream region, position in the sequence: -466) and GAAACTCACACTGCTGTCAGC (downstream region, position in the 3' flanking sequence: +448) for amplification after the second ligation.

Then, we calculate the average number of binding sites per position in the sequence and Z score for each position.