Sentence examples for position products from inspiring English sources

How do managers position products in Germany, for example?

Supermarkets and drugstores accept billions of dollars a year in "slotting fees" to position products at the end of an aisle or at eye level.

He calls neuromarketing an "iffy technology," a kind of pop neurology that at best may provide cues and clues on how companies can better position products.

One obvious conclusion would be that diverse selling approaches, ones that position products in both physical and thematic contexts, are more likely to appeal to a wide range of consumers.

Although retailers think they know how to position products in a way that will maximise sales, says Peter Hoyt of the In-store Marketing Institute, "the science of adjacency is not a science".

"They're trying to position products to appeal to both, and not just rely on pester power".

This overview is an attempt to position product technology as a scientific discipline that covers the area of product design and engineering.

Table 1 Primer sequences and probes designed in the study Primer Sequence (5′ → 3′) Genomic position Product length (bp) F1 R1 CGGAATTCAGTCCGCGAAGAAGTTTTTG CCCTCGAGGCGAGTCCGAGAAGAATACG 125 622 514 F2 R2 GGGCTCTACTCCACCAACAA CGAGTCCGAGAAGAATACGC 442 621 180.

"The Boy Scouts of America is wholly non-partisan and does not promote any one position, product, service, political candidate or philosophy," the organization said in a statement.

The statement reads: "The Boy Scouts of America is wholly non-partisan and does not promote any one position, product, service, political candidate or philosophy.

The Boy Scouts of America released a statement late Monday to a reporter who asked about its political stance, saying the organization was "wholly non-partisan and does not promote any one position, product, service, political candidate or philosophy".