We compared the two groups if the cage was inserted parallel to the vertebral endplate and if the anterior, middle, and posterior portions of the inserted cage were all in contact with the endplate in the sagittal plane.
This observation was further supported by bleaching the entire cell body, resulting in swift recovery of fluorescence to the portion of the flagellum inserted into the pocket but not to the cell body membrane.
Self-propelled rotary tools (SPRT) employs round inserts rotating continuously about its axis as a result of the driving motion impacted by the cutting force, thus minimising the effect of thermal energy along the entire edge and preventing excessive heating of a particular portion of the insert edge.
A portion of the insert sequence follows with the primer binding sites indicated in bold face type and the probe binding site underlined: 5'- CAGACCGCTCGACGATAGG T CAGCACTGTCTCGTTGACAGGCGTGGTCAATCAGCCTGAAATCCTCGATCAGAGTGTGC CG ATCTCTGGTCCACGTCCT -3'.
The 3′pac-2A-GT-ECFP pofthen of the insert was then removed by BglII restriction, blunt-ended (Klenow fill-in) and restricted with SacII.
L. 99 474, § 2(g), substituted a dash for the comma after "As used in this section", realigned remaining portion of subsection, inserted "(1)" before "the term", substituted a semicolon for the period at the end, and added pars.
RepeatMasker analysis [ 21] of the insert shows 13.1% divergence, 13.1% deletion and 3.2% insertion relative to the consensus MuRVY LTR sequence, and 32.5% divergence for non-LTR portions of the insert.
Dr. Spadafora and colleagues hypothesize that both L1-dependent transcriptional interference and non-random retrotransposition events that are followed, at least in embryos, by the excision of a portion of newly inserted L1 copies might have a role in these cell systems [ 27, 36, 38].
The gold clusters clearly pinpointed that the C terminus of Med14 was located at the tip of the upper portion of the structure and inserted into the distinct dense domain at the base, which corresponded to the Tail module.
A portion of the pellet was inserted into a square borosilicate glass capillary (0.5 mm by 0.5 mm cross section inside diameter, Wale Apparatus, Hellertown, PA) using a 10 μL syringe (Hamilton Co., Reno NV).
