Sentence examples for portion of the insert from inspiring English sources

Self-propelled rotary tools (SPRT) employs round inserts rotating continuously about its axis as a result of the driving motion impacted by the cutting force, thus minimising the effect of thermal energy along the entire edge and preventing excessive heating of a particular portion of the insert edge.

The 3′pac-2A-GT-ECFP pofthen of the insert was then removed by BglII restriction, blunt-ended (Klenow fill-in) and restricted with SacII.

A portion of the insert sequence follows with the primer binding sites indicated in bold face type and the probe binding site underlined: 5'- CAGACCGCTCGACGATAGG T CAGCACTGTCTCGTTGACAGGCGTGGTCAATCAGCCTGAAATCCTCGATCAGAGTGTGC CG ATCTCTGGTCCACGTCCT -3'.

In every other case, the insertion site itself and a major portion of the inserted TE are similar in all species in which the TE appears (see Figure 3 for examples).

RepeatMasker analysis [ 21] of the insert shows 13.1% divergence, 13.1% deletion and 3.2% insertion relative to the consensus MuRVY LTR sequence, and 32.5% divergence for non-LTR portions of the insert.

Although the CLK-specific hairpin partially overlaps with the β-mesh portion of the CpCDPK4 insert, it is distinct in orientation and lacks sequence identity to the CpCDPK4 insert.

We compared the two groups if the cage was inserted parallel to the vertebral endplate and if the anterior, middle, and posterior portions of the inserted cage were all in contact with the endplate in the sagittal plane.

bovis DNA was modified to remove a portion of the hspX insert used by the reverse hspX primer.

This observation was further supported by bleaching the entire cell body, resulting in swift recovery of fluorescence to the portion of the flagellum inserted into the pocket but not to the cell body membrane.

It is easier to advance the graft passing the thinner end first (normally, the portion of the tendon inserting on the pes anserinus) with local anaesthetic jelly (Instillagel, Farco Pharma, Cologne).

Push out a small portion of air, insert the aspirator into the very front portion for the nostril, and gently release the bulb.