Your English writing platform
Discover LudwigSuggestions(1)
Exact(7)
Althaus [49], however, pointed out additionally that BEV charged with electricity with a significant portion of nuclear energy will be associated with a backpack of nuclear waste production.
A comprehensive analysis on South Korea's generation policy using the portfolio model shows that a large annual cost is additionally charged to substitute a portion of nuclear energy with other alternatives.
Much of the research into the properties of neptunium since then has been focused on understanding how to confine it as a portion of nuclear waste.
However, while nuclear DNA could not be amplified by PCR in the extracted mtDNA, we cannot exclude the possibility that a minor portion of nuclear DNA contamination could still exist in our extracted mtDNA.
We targeted portions of five, mitochondrial protein coding genes for PCR amplification: ATP6 (506 bp), COI (844 bp), COIII (711 bp), CYTB (795 bp), and ND6 (493 bp); as well as a portion of nuclear ribosomal 28S (~1,050 bp) for 275 individuals (265 ingroup, ten outgroup) from 40 sample localities (38 ingroup, two outgroup) across western North America.
Other studies make use of a large portion of nuclear genetic material by considering paralogous copies in gene families, with the added complexity of dealing with gene duplications and losses (Maddison 1997; Page 1998; Maddison and Knowles 2006; Wehe et al. 2008).
Similar(53)
The four autosomal regions were portions of nuclear loci initially chosen for their potential role in the development of butterfly wing patterns [ 30].
The forward primer 5'CCCCTandTAACCGGTGGTC3' and reverse primer 5'GAAGCGGCGAATATCTCACA3' were used to amplify a 113-bp region of the Arabidopsis nuclear DNA encompassing a 5' portion of the nuclear ROC1 gene and an upstream intergenic region.
Raw intensity traces for the photobleached region of the nuclear envelope were normalized using the unbleached portion of the nuclear envelope to correct for 'background' bleaching caused by the imaging laser.
During his testimony before the senate committee, Darnell stated that "the Air Force portion of the nuclear deterrent is sound, and we will take every measure necessary to provide safe, secure, reliable nuclear surety to the American public".
A hydride dehydride process was evaluated to recover a portion of spent nuclear fuel cladding; a zirconium alloy (Zircaloy), as a metal powder that may be used for advanced nuclear fuel applications.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com