Sentence examples for portion of mutated from inspiring English sources

Mutations in epigenetic regulators are found in approximately half of hepatocellular carcinoma and bladder cancers, and represent a significant portion of mutated genes in medulloblastoma (Gui et al., 2011; Fujimoto et al., 2012; Pugh et al., 2012).

In that scenario, the risk of an overlap with the non-mutated portion of the receptor and inclusion into the immune response to mount autoimmunity is higher.

The CD22-RTM was designed to replace the mutated segment of CD22 intron 12 and downstream portion of the CD22ΔE12 gene with mutation-free wildtype CD22 Exons 10 14 (Uckun et al., 2015a).

Our CD22-RTM was designed to replace the mutated segment of CD22 intron 12 and the downstream portion of the CD22ΔE12 gene with mutation-free wildtype CD22 Exons 10 14 (Uckun et al., 2015a).

Adam Gopnik on our age of mutated pastry.

"It sounded like some kind of mutated devolved reggae," Casale said, of the rhythm.

Herbert said her group was already working on ways to reduce the carryover of mutated DNA.

Vemurafenib and dabrafenib are inhibitors of mutated BRAF signaling.

Some sort of mutated Beanie Babie?

The target of the mutated siFIP200#1 is CTGGGACGGATACAAATCCAA; and the target of mutated siFIP200 2, ACGCAAGTCCGTTGATGATTA.

List of mutated LOV2 domain residues.