In this way an extinction curve was generated by plotting the number of remaining species on the one side against the cumulative number of species removed from the other side.
She said: "The disruption of this IED plot underscores the necessity of remaining vigilant against terrorism here and abroad.
She added: "The disruption of this IED [improvised explosive device] plot underscores the necessity of remaining vigilant against terrorism here and abroad".
We use a highly optimized version of DPL to plot the average number of remaining variables versus search tree depth for several nontrivial sizes of critically constrained, underconstrained, and overconstrained problems.
A Kaplan-Meier plot for the probability of remaining in the ICU according to the clinical distinction of Ever Delirium vs Never Delirium is shown in Fig. 1.
Levels of mRNA were then standardized against 18s rRNA levels with primers 18SF: 5' CCCCTCGATGCTCTTAGCTGAGTGT 3' and 18SR: 5' CGCCGGTCCAAGAATTTCACCTCT 3', taking into account a previous determination of 65 hours for 18s rRNA half life [95], and plotted as the percentage of remaining mRNA compared to message levels at the 0 time point (where there is a 100% maximum mRNA level).
Histogram plots represent the number of remaining TH-positive cells in the SNpc 21 days after the last injection of MPTP.
Cooper felt that the episode was a satisfying conclusion to the season opining that "by allowing some of its plots to remain tantalizing mysteries, yet offering up the satisfaction of explaining others, 'Desperate Housewives' has smartly set things up for its audience to return for its new season next fall".
On inspecting the property, Ms. Antinori found that despite the prince's most destructive efforts, a small plot of vines remained, four rows of cabernet sauvignon and four rows of merlot.
Kaplan-Meier survival curves were plotted to estimate the probability of remaining free of myocardial infarction during follow-up.
Finally, Kaplan-Meier survival curves were plotted to estimate the probability of remaining free of myocardial infarction during follow-up.
