All elements in the AHP PCM were then picked to check the weight sensitivity.
I also learned do's and dont's, such as where to place my ice-pick to check for stability on the ice, and how to utilize that same pick to secure me, once I started ice-climbing, and to stay away from snow on the top of ice- a likely crevace, which I wouldn't want to fall into.
Prior to sequencing, 52 clones were randomly picked to check for the presence of inserts by colony-PCR using the M13 forward and reverse primers.
To investigate whether there were artifacts in the data, or if the different cell lines differed in overall expression levels, randomly sampled gene products were picked to check their correlation coefficients.
Twelve colonies were picked and screened by PCR to check for loss of the selection cassette (Primers RyR2f: GGGGAGTTGGCTGCTGAGAA; RyR2r: CGGGCACACACTCACCACCAA).
Rinse the beans and pick over to check for stones.
We used several different picking profiles to check robot performance under all three conditions.
When Kelaine Conochan, a sophomore at the University of Maryland here, was choosing courses for this semester, she went online to Pick-a-Prof to check out the teachers -- and their grading patterns.
Rebanks hopped in and out of the enclosures, picking up lambs to check their bellies for milk, and gently admonishing their mothers ("You can't step on it") as they fussed around him.
For those of you who haven't already blocked out those 408 hours, here are VICE's picks for what to check out at the festival.
Follow Harry Cheadle on Thanksr.
