Sentence examples for performed using the same conditions from inspiring English sources

Exact(14)

XRD and EIS measurements were performed using the same conditions as described in Ref. [10].

The second anodisation step to make the final TNT layer on Ti wire was performed using the same conditions.

Typically, three preparation runs are performed using the same conditions set for normal routine preparations, but without using radioactivity and avoiding final sterilization (e.g. in case the RP solution has to be sterilized by filtration, filter is not included in the preparations dedicated to bioburden testing).

Carboplatin and paclitaxel treatment were performed using the same conditions as in vitro.

A scaled-up (96 wells with 10 µl of 1∶1000 PCR product from the first round per reaction) PCR with the nested primers Hbb-b1 Anchor BamHI (TAGGATCCAGGTAGAACCCTTGCCTGTTTT) and Nested Vectorette Primer (ACCGTTCGTACGAGAATCGCT) was performed using the same conditions as the first round PCR except 30 cycles of PCR were used.

Polymerization was performed using the same conditions described in Formaldehyde "Stopped" Reactions.

Show more...

Similar(44)

For the GSL2 gene, PCR was performed using the same PCR conditions with 58°C annealing temperature.

All PCR reactions are performed using the same reaction conditions, enabling an automated workflow.

Alignment of the 63 bp sequences to the F. vesca genome was performed using the same stringent conditions used previously.

The PCR for the GSL2 coding region was performed using the same PCR conditions with 57°C annealing temperature.

PCR was performed using the same reaction conditions as above but allowed to proceed for only 12 cycles.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: