Your English writing platform
Discover LudwigSuggestions(2)
Exact(3)
Staining steps were performed to attach florescent dyes to the labeled nucleotides and the array surface sealed to protect the dyes from atmospheric degradation.
Cytospin was subsequently performed to attach the cells to glass slides with centrifugation force.
To facilitate in vitro transcription, PCR amplification was performed to attach a T7 promoter sequence (TAATACGACTCACTATAGGG) to the 5' and 3' end of the target sequences.
Similar(57)
In the laboratory it means that biotechnologists can create antibodies with active sites tailored to perform particular tasks.One task they are often asked to perform is to attach themselves to a cancer cell.
Three plating trials comprised of six samples were performed to evaluate the ability to attach thin strips of varying cross section to a copper substrate via commercial nickel electroplating in a nickel sulfamate bath.
An MTT assay was performed to evaluate the number of attached cells after 4 h and 6 days of plating, which may reflect the proliferation or survival rate.
However, several problems exists, such as the high cost of the equipment; as with other new intraoperative techniques, there is a relevant learning curve; an additional incision has to be performed, in order to attach the reference clamp.
The nodes have to perform extra task to attach the spectrum-related information as well as to send longer packets.
In our example, an ADR mission with a chemical propulsion system performs a rendezvous manoeuvre to attach a solid rocket motor to a target object, which subsequently fires under remote command to de-orbit the target.
Predictability of the results becomes so simple because you know exactly what tasks need to be performed by attaching a number to them.
The results showed that antibacterial DIO-NPs were performed by attaching dextran to iron oxide using a coprecipitation method.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com