Sentence examples for performed in quadruplicate to from inspiring English sources

Each experimental point was performed in quadruplicate to obtain the mean and standard deviation values.

Reactions were performed in quadruplicate at 50°C.

All measurements were performed in quadruplicate and repeated to confirm the data.

PCR reactions were performed in quadruplicate and normalized to the housekeeping Gapdh.

Quantification reactions for the target transcripts at each timepoint were performed in quadruplicate and normalized to concurrently analyzed gyrA mRNA levels from the same sample.

All real-time qPCR reactions were performed in quadruplicate with gDNA according to the manufacturer's protocol using a 7500 Fast Real-Time PCR system (Life Technologies, Foster City, CA, USA).

The reactions were performed in an ABI Prism 7700 machine with real-time SYBR Green I detection using default parameters and the primers 5'andGAGCAGGATGTGAAATG3' and 5'AACGAGCAGGATGTGAAATCG3'. Reactions were performed in quadruplicate for each template to assess standard deviation of threshold cycle (Ct) measurements of the amount of CrChlI transcripts in the green and colorless samples.

qPCR reactions were performed in quadruplicate with genomic DNA (gDNA) according to the manufacturer's protocol and cycling conditions in 7500 Fast Real-Time PCR (Applied Biosystems, USA).

All assays were performed in quadruplicate.

These experiments were performed in quadruplicate and repeated twice.

At least four independent experiments were performed in quadruplicate.