Sentence examples for pcr apparatus from inspiring English sources
Samples for quantitative PCR were analyzed with an ABI Step One PCR apparatus (Applied Biosystems, Foster City, CA, USA).
cDNA corresponding to 20, 200, 500 ng and 1 μg of total RNA coming from the immortalized cell lines of the c.7041+8G/A heterozygote carrier, as well as nine wild-type individuals, were used to perform fluorescent-based real-time PCR quantification using the Light Cycler Real-Time PCR apparatus (Roche Inc, Nutley, NJ).
qRT-PCR was carried out in a Rotor-Gene 6000 PCR apparatus (Corbett Robotics, Australia) by adding 10 μl of SsoFast EvaGreen Supermix (Bio-Rad), 200 ng of cDNA, 0.5pmol of each primer and water to a final volume of 20 μL.
Briefly, samples were first submitted to a PCR using two primers: D75 = 5'– CAGATCTTGGTTGGCGTAG 3' and D72 = 5'– TTTTCAGAATGGCCGAACAGT–3'). Two microliters of these PCR products were used as template in the second PCR round performed in a real time PCR apparatus (ABI7900 - Applied Biosystems), using the primers: D71 (5'-AAGGTGCGTCGACAGTGTGG-3') and D72.
Real-time PCR apparatus (CFX96, Bio-Rad), associated with CFX Manager Software (version 1.6, Bio-Rad), was used for the real-time PCR.
In this paper a proton Computed Radiography (pCR) apparatus for medical applications, realized by PRIMA (PRoton IMAging) Italian Collaboration, is described.
QRT-PCR reactions were performed in a 7500 Real Time PCR System apparatus (Applied Biosystems).
Quantitative RT-PCR was performed by using SYBR Green dye chemistry (Applied Biosystems) on a 7500 Real-time PCR system apparatus (Applied Biosystems).
Quantitative RT-PCR was performed by using SYBR green (Applied Biosystems, Foster City, CA) as a marker for DNA amplification on a 7500 Real-Time PCR System apparatus (Applied Biosystems, Foster City, CA).
Reactions were done in a real-time PCR 7500 apparatus (Applied Biosystems) in a final volume of 20 μL using 100 ng of cDNA and 10 μL of TaqMan Universal Master Mix II Applied Biosystemss, Foster City, CA, USA).
Q-PCR was performed using SyberGreen Qiagen) and the Biorad q-PCR CFX96 apparatus.
