Sentence examples for pci it from inspiring English sources

From a composition with only PCI, it has gradually been replaced by bottom ash in different proportions, trying to keep similar ratios to those of Portland cement type II (CPI + fly ash) and type IV (CPI + pozzolanic material).

Although there are several problems associated with PCI, it should at least be considered for patients with LD-SCLC who achieve CR following initial therapy, after giving the patient a detailed explanation of the advantages and disadvantages.

However, due to the various functions and versatility of PCI it is challenging to investigate PCI protein expression in body fluids [ 34].

Extreme value analysis (EVA) is a tool for PCI, it allows an inspector to build a statistical model of the smallest thicknesses across a component.

In 19 trials that assigned PCI, it was planned that patients who achieved a complete response (CR) or CR/partial response (PR) after induction chemotherapy would receive PCI. Thirteen (25%) of the 52 phase III trials showed a statistically significantly difference in survival time.

At a price of £2500 and with a 20% reduction in HF incidence and mortality after PCI, it is likely that the cardioprotective agent would be cost-effective.

ChAT: Sac I, GGGCTGGGAGCTCCCTCTGA; NFL: Pci I, AGTCAATACATGTATAATTC; TH: Acc65 I, TGCATAGGGTACCACCCACA; VAMP2: BamH I, CTCCCTTGGATCCGTGTGTG. Following electroporation into ES cells and positive and negative selection (G418 and gancyclovir, respectively), colonies were screened by Southern blot hybridization with ∼500 bp probes generated by PCR as shown in Figure 1.

The lacI repressor gene and taclacUV5 promoter of plasmid pCD341 [ 42] were amplified by PCR with Pci I and Sph I site-containing primers (Table 1), TOPO-cloned and sequenced, and excised for ligation into plasmid pCM66 [ 43], resulting in plasmid pMA36.

Empirical expressions are proposed for the collapse pressure of the inner pipe (Pci), and its upper and lower bounds.

Grab your sound card and snap it into the selected pci slot.

Sleeps 6 Book it 0330 555 0034; pci-holidays.com Originally a village house and adjoining barn, Maison Rose has been lovingly transformed into a self-catering villa.