Exact(2)
ChAT: Sac I, GGGCTGGGAGCTCCCTCTGA; NFL: Pci I, AGTCAATACATGTATAATTC; TH: Acc65 I, TGCATAGGGTACCACCCACA; VAMP2: BamH I, CTCCCTTGGATCCGTGTGTG. Following electroporation into ES cells and positive and negative selection (G418 and gancyclovir, respectively), colonies were screened by Southern blot hybridization with ∼500 bp probes generated by PCR as shown in Figure 1.
The lacI repressor gene and taclacUV5 promoter of plasmid pCD341 [ 42] were amplified by PCR with Pci I and Sph I site-containing primers (Table 1), TOPO-cloned and sequenced, and excised for ligation into plasmid pCM66 [ 43], resulting in plasmid pMA36.
Similar(58)
The competent cells were prepared as before and electro-transformed with Hind-III and Pci-I digested pMDXD.
Entry cost per call at port i ⋅ pci = 5000 RMB.
To exhaustively describe M in terms of first-order sentences, we need an infinite list ⟨li : i < ω⟩ of literals, where li := Pci, if di ∈ PM, and li := ¬Pci, if di ∉ >PM.
When choosing a video card make sure you have the correct connection on your motherboard (ex. pci-e x16 v2, AGP, PCI, PCI-E x16 v1) and calculate the power usage and buy your power supply accordingly.
The relationship between the space coordinates pwi Xwi,Ywi,Zwi) (i = 1,…,n) of the i th feature point and their corresponding coordinates pci (u i,v i )in the image plane can be described as follows w · u i w · v i w = f 0 0 0 0 f 0 0 0 0 1 0 R t 0 1 X wi Y wi Z wi 1 (1).
If [(wus − wmx) > (pcus − cmx)], wus > wmx, and p > 1, I expect this term to be positive (i.e., each month spent in the USA increases the migrant's lifetime wealth).
The proposed empirical equation for Pci, is shown to agree well with the experimental results of the tested PIPs.
Empirical expressions are proposed for the collapse pressure of the inner pipe (Pci), and its upper and lower bounds.
Given an i.i.d.i.d
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com