Sentence examples for pattern implementation from inspiring English sources
"pattern implementation" is a correct and usable phrase in written English
It can refer to the process of putting a pattern into practice or action. Example: "The company is known for its efficient pattern implementation, which has greatly improved their productivity and success." Another example: "The program's success is due to its thorough pattern implementation, ensuring that each step is executed precisely."
The agents (software pattern implementation) will be automatically generated based on the specificity of the task.
The next section investigates the robustness of the stimulus-response pattern implementation against perturbations of its internal mechanisms.
We apply our approach on design pattern implementations and two different application program running on servers using CFS scheduling.
Previous studies have found design pattern implementations are naturally crosscutting in object-oriented systems, thereby making it difficult to modularly compose them.
The architecture contains top-level patterns, abstract patterns, and implementation patterns.
The pattern-based approach also requires libraries of existing design patterns, implementation patterns, and compilation templates.
As Madagascar is a large island and have different climate patterns, implementation of the sentinel centers were carried to give geographical representativity and to provide best information about the trends in each of these climate areas.
Also some attributes of specific Design Patterns like "implementation" or "code example" were not containing enough information and the users were reloading the specific info tab to get content.
Fig. 2 Dropout pattern during implementation of the MOOC Free Software and Open Knowledge (case 1) Fig. 3 Dropout pattern during the implementation of the MOOC Applied Educational Innovation (case 2).
In the second step for finding the best core pattern and implementation of the objectives listed, GSA algorithm has been performed for case of WWER1000 reactor.
When searching for ER binding sites, in addition to predicted TFBSs as described above, information from TRANSFAC [41] and pattern search implementation using 3 consensus sequences, TCGACGCTTTCAAGGTCATATCCG, TCGACAAAGTCAGGTCACAGTGACCTGATCAAG and GGTCANNNTGACC, where 'N' represents an arbitrary nucleotide, [9], [42] were also utilized.
